Antibodies
Anti-POLR2L Antibody-Oligo Conjugate
SKU: aoc3163
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-POLR2L Antibody-IF1
Antibody Target
- Target
- DNA-directed RNA polymerases I, II, and III subunit RPABC5
- UniProt Number
- P62875
- Target Description
- DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates. Common component of RNA polymerases I, II and III which synthesize ribosomal RNA precursors, mRNA precursors and many functional non-coding RNAs, and a small RNAs, such as 5S rRNA and tRNAs, respectively.
- Molecular Weight
- 8kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC63914
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- A synthetic peptide corresponding to a sequence within amino acids 1-67 of human POLR2L (NP_066951.1).
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat