Antibodies
Anti-PP1 beta Antibody-Oligo Conjugate
SKU: aoc3166
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PP1 beta Antibody-IF1
Antibody Target
- Target
- Serine/threonine-protein phosphatase PP1-beta catalytic subunit
- UniProt Number
- P62140
- Target Description
- Protein phosphatase that associates with over 200 regulatory proteins to form highly specific holoenzymes which dephosphorylate hundreds of biological targets. Protein phosphatase (PP1) is essential for cell division, it participates in the regulation of glycogen metabolism, muscle contractility and protein synthesis. Involved in regulation of ionic conductances and long-term synaptic plasticity. Component of the PTW/PP1 phosphatase complex, which plays a role in the control of chromatin structure and cell cycle progression during the transition from mitosis into interphase. In balance with CSNK1D and CSNK1E, determines the circadian period length, through the regulation of the speed and rhythmicity of PER1 and PER2 phosphorylation. May dephosphorylate CSNK1D and CSNK1E. Dephosphorylates the 'Ser-418' residue of FOXP3 in regulatory T-cells (Treg) from patients with rheumatoid arthritis, thereby inactivating FOXP3 and rendering Treg cells functionally defective. Core component of the SHOC2-MRAS-PP1c (SMP) holophosphatase complex that regulates the MAPK pathway activation. The SMP complex specifically dephosphorylates the inhibitory phosphorylation at 'Ser-259' of RAF1 kinase, 'Ser-365' of BRAF kinase and 'Ser-214' of ARAF kinase, stimulating their kinase activities. The SMP complex enhances the dephosphorylation activity and substrate specificity of PP1c.
- Molecular Weight
- 37kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC0981
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat