Antibodies

Anti-PP2A alpha/beta Antibody-Oligo Conjugate

SKU: aoc3167

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-PP2A alpha/beta Antibody-IF1

Antibody Target

Target
Serine/threonine-protein phosphatase 2A catalytic subunit alpha isoform
UniProt Number
P67775
Additional Target Information
This antibody also binds Serine/threonine-protein phosphatase 2A catalytic subunit beta isoform, Uniprot:P62714.
Target Description
Catalytic subunit of protein phosphatase 2A (PP2A), a serine/threonine phosphatase involved in the regulation of a wide variety of enzymes, signal transduction pathways, and cellular events. PP2A is the major phosphatase for microtubule-associated proteins (MAPs). PP2A can modulate the activity of phosphorylase B kinase casein kinase 2, mitogen-stimulated S6 kinase, and MAP-2 kinase. Cooperates with SGO2 to protect centromeric cohesin from separase-mediated cleavage in oocytes specifically during meiosis I. Can dephosphorylate various proteins, such as SV40 large T antigen, AXIN1, p53/TP53, PIM3, WEE1. Activates RAF1 by dephosphorylating it at 'Ser-259'. Mediates dephosphorylation of WEE1, preventing its ubiquitin-mediated proteolysis, increasing WEE1 protein levels, and promoting the G2/M checkpoint. Mediates dephosphorylation of MYC; promoting its ubiquitin-mediated proteolysis: interaction with AMBRA1 enhances interaction between PPP2CA and MYC. Mediates dephosphorylation of FOXO3; promoting its stabilization: interaction with AMBRA1 enhances interaction between PPP2CA and FOXO3. Catalyzes dephosphorylation of the pyrin domain of NLRP3, promoting assembly of the NLRP3 inflammasome. Together with RACK1 adapter, mediates dephosphorylation of AKT1 at 'Ser-473', preventing AKT1 activation and AKT-mTOR signaling pathway. Dephosphorylation of AKT1 is essential for regulatory T-cells (Treg) homeostasis and stability. Catalyzes dephosphorylation of PIM3, promotinh PIM3 ubiquitination and proteasomal degradation. Part of the striatin-interacting phosphatase and kinase (STRIPAK) complexes. STRIPAK complexes have critical roles in protein (de)phosphorylation and are regulators of multiple signaling pathways including Hippo, MAPK, nuclear receptor and cytoskeleton remodeling. Different types of STRIPAK complexes are involved in a variety of biological processes such as cell growth, differentiation, apoptosis, metabolism and immune regulation. Key mediator of a quality checkpoint during transcription elongation as part of the Integrator-PP2A (INTAC) complex. The INTAC complex drives premature transcription termination of transcripts that are unfavorably configured for transcriptional elongation: within the INTAC complex, PPP2CA catalyzes dephosphorylation of the C-terminal domain (CTD) of Pol II subunit POLR2A/RPB1 and SUPT5H/SPT5, thereby preventing transcriptional elongation.
Molecular Weight
36kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBIHCICCELISA
Clone
ARC1889
Isotype
IgG
Form
Liquid
Immunogen
Synthetic peptide. This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
HumanMouseRat