Antibodies
Anti-PPID Antibody-Oligo Conjugate
SKU: aoc3171
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PPID Antibody-IF1
Antibody Target
- Target
- Peptidyl-prolyl cis-trans isomerase D
- UniProt Number
- Q08752
- Target Description
- PPIase that catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides and may therefore assist protein folding. Proposed to act as a co-chaperone in HSP90 complexes such as in unligated steroid receptors heterocomplexes. Different co-chaperones seem to compete for association with HSP90 thus establishing distinct HSP90-co-chaperone-receptor complexes with the potential to exert tissue-specific receptor activity control. May have a preference for estrogen receptor complexes and is not found in glucocorticoid receptor complexes. May be involved in cytoplasmic dynein-dependent movement of the receptor from the cytoplasm to the nucleus. May regulate MYB by inhibiting its DNA-binding activity. Involved in regulation of AHR signaling by promoting the formation of the AHR:ARNT dimer; the function is independent of HSP90 but requires the chaperone activity. Involved in regulation of UV radiation-induced apoptosis. Promotes cell viability in anaplastic lymphoma kinase-positive anaplastic large-cell lymphoma (ALK+ ALCL) cell lines.; FUNCTION: (Microbial infection) May be involved in hepatitis C virus (HCV) replication and release.
- Molecular Weight
- 41kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1260
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat