Antibodies
Anti-PREB Antibody-Oligo Conjugate
SKU: aoc3183
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PREB Antibody-IF1
Antibody Target
- Target
- Guanine nucleotide-exchange factor SEC12
- UniProt Number
- Q9HCU5
- Target Description
- Guanine nucleotide exchange factor (GEF) that regulates the assembly of the coat protein complex II/COPII in endoplasmic reticulum (ER) to Golgi vesicle-mediated transport. Selectively activates SAR1A and SAR1B by promoting the exchange of guanosine diphosphate (GDP) for guanosine triphosphate (GTP) in these small GTPases. In their activated GTP-bound state, SAR1A and SAR1B insert into the membrane of the endoplasmic reticulum where they recruit the remainder of the coat protein complex II/COPII which is responsible for both the sorting of proteins and the deformation and budding of membranes into vesicles destined to the Golgi.; FUNCTION: Was first identified based on its probable role in the regulation of pituitary gene transcription. Binds to the prolactin gene (PRL) promoter and seems to activate transcription.
- Molecular Weight
- 45kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC2945
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat