Antibodies
Anti-PRKRA/PACT Antibody-Oligo Conjugate
SKU: aoc3187
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PRKRA/PACT Antibody-IF1
Antibody Target
- Target
- Interferon-inducible double-stranded RNA-dependent protein kinase activator A
- UniProt Number
- O75569
- Target Description
- Activates EIF2AK2/PKR in the absence of double-stranded RNA (dsRNA), leading to phosphorylation of EIF2S1/EFI2-alpha and inhibition of translation and induction of apoptosis. Required for siRNA production by DICER1 and for subsequent siRNA-mediated post-transcriptional gene silencing. Does not seem to be required for processing of pre-miRNA to miRNA by DICER1. Promotes UBC9-p53/TP53 association and sumoylation and phosphorylation of p53/TP53 at 'Lys-386' at 'Ser-392' respectively and enhances its activity in a EIF2AK2/PKR-dependent manner.
- Molecular Weight
- 34kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1299
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat