Antibodies
Anti-PRMT1 Antibody-Oligo Conjugate
SKU: aoc3188
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PRMT1 Antibody-IF1
Antibody Target
- Target
- Protein arginine N-methyltransferase 1
- UniProt Number
- Q99873
- Target Description
- Arginine methyltransferase that methylates (mono and asymmetric dimethylation) the guanidino nitrogens of arginyl residues present in proteins such as ESR1, histone H2, H3 and H4, FMR1, ILF3, HNRNPA1, HNRNPD, NFATC2IP, SUPT5H, TAF15, EWS, HABP4, SERBP1, RBM15, FOXO1, CHTOP, MAP3K5/ASK1, MICU1 and NPRL2. Constitutes the main enzyme that mediates monomethylation and asymmetric dimethylation of histone H4 'Arg-3' (H4R3me1 and H4R3me2a, respectively), a specific tag for epigenetic transcriptional activation. May be involved in the regulation of TAF15 transcriptional activity, act as an activator of estrogen receptor (ER)-mediated transactivation, play a key role in neurite outgrowth and act as a negative regulator of megakaryocytic differentiation, by modulating p38 MAPK pathway. Methylates RBM15, promoting ubiquitination and degradation of RBM15. Methylates MRE11 and TP53BP1, promoting the DNA damage response. Methylates FOXO1 and retains it in the nucleus increasing its transcriptional activity. Methylates CHTOP and this methylation is critical for its 5-hydroxymethylcytosine (5hmC)-binding activity. Methylates MAP3K5/ASK1 at 'Arg-78' and 'Arg-80' which promotes association of MAP3K5 with thioredoxin and negatively regulates MAP3K5 association with TRAF2, inhibiting MAP3K5 stimulation and MAP3K5-induced activation of JNK. Methylates H4R3 in genes involved in glioblastomagenesis in a CHTOP- and/or TET1-dependent manner. Plays a role in regulating alternative splicing in the heart. Methylates NPRL2 at 'Arg-78' leading to inhibition of its GTPase activator activity and then the GATOR1 complex and consequently inducing timely mTORC1 activation under methionine-sufficient conditions.
- Molecular Weight
- 42kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC1066
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat