Antibodies
Anti-PRMT5 Antibody-Oligo Conjugate
SKU: aoc3189
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PRMT5 Antibody-IF1
Antibody Target
- Target
- Protein arginine N-methyltransferase 5
- UniProt Number
- O14744
- Target Description
- Arginine methyltransferase that can both catalyze the formation of omega-N monomethylarginine (MMA) and symmetrical dimethylarginine (sDMA), with a preference for the formation of MMA. Specifically mediates the symmetrical dimethylation of arginine residues in the small nuclear ribonucleoproteins Sm D1 (SNRPD1) and Sm D3 (SNRPD3); such methylation being required for the assembly and biogenesis of snRNP core particles. Methylates SUPT5H and may regulate its transcriptional elongation properties. May methylate the N-terminal region of MBD2. Mono- and dimethylates arginine residues of myelin basic protein (MBP) in vitro. May play a role in cytokine-activated transduction pathways. Negatively regulates cyclin E1 promoter activity and cellular proliferation. Methylates histone H2A and H4 'Arg-3' during germ cell development. Methylates histone H3 'Arg-8', which may repress transcription. Methylates the Piwi proteins (PIWIL1, PIWIL2 and PIWIL4), methylation of Piwi proteins being required for the interaction with Tudor domain-containing proteins and subsequent localization to the meiotic nuage. Methylates RPS10. Attenuates EGF signaling through the MAPK1/MAPK3 pathway acting at 2 levels. First, monomethylates EGFR; this enhances EGFR 'Tyr-1197' phosphorylation and PTPN6 recruitment, eventually leading to reduced SOS1 phosphorylation. Second, methylates RAF1 and probably BRAF, hence destabilizing these 2 signaling proteins and reducing their catalytic activity. Required for induction of E-selectin and VCAM-1, on the endothelial cells surface at sites of inflammation. Methylates HOXA9. Methylates and regulates SRGAP2 which is involved in cell migration and differentiation. Acts as a transcriptional corepressor in CRY1-mediated repression of the core circadian component PER1 by regulating the H4R3 dimethylation at the PER1 promoter. Methylates GM130/GOLGA2, regulating Golgi ribbon formation. Methylates H4R3 in genes involved in glioblastomagenesis in a CHTOP- and/or TET1-dependent manner. Symmetrically methylates POLR2A, a modification that allows the recruitment to POLR2A of proteins including SMN1/SMN2 and SETX. This is required for resolving RNA-DNA hybrids created by RNA polymerase II, that form R-loop in transcription terminal regions, an important step in proper transcription termination. Along with LYAR, binds the promoter of gamma-globin HBG1/HBG2 and represses its expression. Symmetrically methylates NCL. Methylates p53/TP53; methylation might possibly affect p53/TP53 target gene specificity. Involved in spliceosome maturation and mRNA splicing in prophase I spermatocytes through the catalysis of the symmetrical arginine dimethylation of SNRPB (small nuclear ribonucleoprotein-associated protein) and the interaction with tudor domain-containing protein TDRD6.
- Molecular Weight
- 73kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0011
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat