Antibodies

Anti-PRMT5 Antibody-Oligo Conjugate

SKU: aoc3189

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-PRMT5 Antibody-IF1

Antibody Target

Target
Protein arginine N-methyltransferase 5
UniProt Number
O14744
Target Description
Arginine methyltransferase that can both catalyze the formation of omega-N monomethylarginine (MMA) and symmetrical dimethylarginine (sDMA), with a preference for the formation of MMA. Specifically mediates the symmetrical dimethylation of arginine residues in the small nuclear ribonucleoproteins Sm D1 (SNRPD1) and Sm D3 (SNRPD3); such methylation being required for the assembly and biogenesis of snRNP core particles. Methylates SUPT5H and may regulate its transcriptional elongation properties. May methylate the N-terminal region of MBD2. Mono- and dimethylates arginine residues of myelin basic protein (MBP) in vitro. May play a role in cytokine-activated transduction pathways. Negatively regulates cyclin E1 promoter activity and cellular proliferation. Methylates histone H2A and H4 'Arg-3' during germ cell development. Methylates histone H3 'Arg-8', which may repress transcription. Methylates the Piwi proteins (PIWIL1, PIWIL2 and PIWIL4), methylation of Piwi proteins being required for the interaction with Tudor domain-containing proteins and subsequent localization to the meiotic nuage. Methylates RPS10. Attenuates EGF signaling through the MAPK1/MAPK3 pathway acting at 2 levels. First, monomethylates EGFR; this enhances EGFR 'Tyr-1197' phosphorylation and PTPN6 recruitment, eventually leading to reduced SOS1 phosphorylation. Second, methylates RAF1 and probably BRAF, hence destabilizing these 2 signaling proteins and reducing their catalytic activity. Required for induction of E-selectin and VCAM-1, on the endothelial cells surface at sites of inflammation. Methylates HOXA9. Methylates and regulates SRGAP2 which is involved in cell migration and differentiation. Acts as a transcriptional corepressor in CRY1-mediated repression of the core circadian component PER1 by regulating the H4R3 dimethylation at the PER1 promoter. Methylates GM130/GOLGA2, regulating Golgi ribbon formation. Methylates H4R3 in genes involved in glioblastomagenesis in a CHTOP- and/or TET1-dependent manner. Symmetrically methylates POLR2A, a modification that allows the recruitment to POLR2A of proteins including SMN1/SMN2 and SETX. This is required for resolving RNA-DNA hybrids created by RNA polymerase II, that form R-loop in transcription terminal regions, an important step in proper transcription termination. Along with LYAR, binds the promoter of gamma-globin HBG1/HBG2 and represses its expression. Symmetrically methylates NCL. Methylates p53/TP53; methylation might possibly affect p53/TP53 target gene specificity. Involved in spliceosome maturation and mRNA splicing in prophase I spermatocytes through the catalysis of the symmetrical arginine dimethylation of SNRPB (small nuclear ribonucleoprotein-associated protein) and the interaction with tudor domain-containing protein TDRD6.
Molecular Weight
73kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBIHCELISA
Clone
ARC0011
Isotype
IgG
Form
Liquid
Immunogen
Synthetic peptide. This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
HumanMouseRat