Antibodies
Anti-Prohibitin 2 Antibody-Oligo Conjugate
SKU: aoc3193
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Prohibitin 2 Antibody-IF1
Antibody Target
- Target
- Prohibitin-2
- UniProt Number
- Q99623
- Target Description
- Protein with pleiotropic attributes mediated in a cell-compartment- and tissue-specific manner, which include the plasma membrane-associated cell signaling functions, mitochondrial chaperone, and transcriptional co-regulator of transcription factors and sex steroid hormones in the nucleus.; FUNCTION: In the mitochondria, together with PHB, forms large ring complexes (prohibitin complexes) in the inner mitochondrial membrane (IMM) and functions as a chaperone protein that stabilizes mitochondrial respiratory enzymes and maintains mitochondrial integrity in the IMM, which is required for mitochondrial morphogenesis, neuronal survival, and normal lifespan (Probable). The prohibitin complex, with DNAJC19, regulates cardiolipin remodeling and the protein turnover of OMA1 in a cardiolipin-binding manner. Also regulates cytochrome-c oxidase assembly (COX) and mitochondrial respiration. Binding to sphingoid 1-phosphate (SPP) modulates its regulator activity. Has a key role of mitophagy receptor involved in targeting mitochondria for autophagic degradation. Involved in mitochondrial-mediated antiviral innate immunity, activates RIG-I-mediated signal transduction and production of IFNB1 and pro-inflammatory cytokine IL6.; FUNCTION: In the nucleus, serves as transcriptional co-regulator (Probable). Acts as a mediator of transcriptional repression by nuclear hormone receptors via recruitment of histone deacetylases. Functions as an estrogen receptor (ER)-selective coregulator that potentiates the inhibitory activities of antiestrogens and represses the activity of estrogens. Competes with NCOA1 for modulation of ER transcriptional activity.; FUNCTION: In the plasma membrane, is involved in IGFBP6-induced cell migration. Cooperates with CD86 to mediate CD86-signaling in B lymphocytes that regulates the level of IgG1 produced through the activation of distal signaling intermediates. Upon CD40 engagement, required to activate NF-kappa-B signaling pathway via phospholipase C and protein kinase C activation.; FUNCTION: (Microbial infection) Involved in human enterovirus 71/EV-71 infection by enhancing the autophagy mechanism during the infection.
- Molecular Weight
- 33kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCIPELISA
- Clone
- ARC1449
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat