Antibodies
Anti-Prostatic Acid Phosphatase (PSAP) Antibody-Oligo Conjugate
SKU: aoc3197
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Prostatic Acid Phosphatase (PSAP) Antibody-IF1
Antibody Target
- Target
- Prostatic acid phosphatase
- UniProt Number
- P15309
- Target Description
- A non-specific tyrosine phosphatase that dephosphorylates a diverse number of substrates under acidic conditions (pH 4-6) including alkyl, aryl, and acyl orthophosphate monoesters and phosphorylated proteins. Has lipid phosphatase activity and inactivates lysophosphatidic acid in seminal plasma.; FUNCTION: [Isoform 2]: Tyrosine phosphatase that acts as a tumor suppressor of prostate cancer through dephosphorylation of ERBB2 and deactivation of MAPK-mediated signaling. In addition to its tyrosine phosphatase activity has ecto-5'-nucleotidase activity in dorsal root ganglion (DRG) neurons. Generates adenosine from AMP which acts as a pain suppressor.; FUNCTION: [PAPf39]: (Microbial infection) Forms amyloid beta-sheet fibrils in semen. These fibrils, termed SEVI (semen-derived enhancer of viral infection) capture HIV virions, attach them to target cells and enhance infection. SEVI amyloid fibrils are degraded by polyphenol epigallocatechin-3-gallate (EGCG), a constituent of green tea. Target cell attachment and enhancement of HIV infection is inhibited by surfen. Also similarly boosts XMRV (xenotropic murine leukemia virus-related virus) infection.
- Molecular Weight
- 45kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC53079
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanRat