Antibodies
Anti-Proteasome 20S LMP7 Antibody-Oligo Conjugate
SKU: aoc3198
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Proteasome 20S LMP7 Antibody-IF1
Antibody Target
- Target
- Proteasome subunit beta type-8
- UniProt Number
- P28062
- Target Description
- The proteasome is a multicatalytic proteinase complex which is characterized by its ability to cleave peptides with Arg, Phe, Tyr, Leu, and Glu adjacent to the leaving group at neutral or slightly basic pH. The proteasome has an ATP-dependent proteolytic activity. This subunit is involved in antigen processing to generate class I binding peptides. Replacement of PSMB5 by PSMB8 increases the capacity of the immunoproteasome to cleave model peptides after hydrophobic and basic residues. Involved in the generation of spliced peptides resulting from the ligation of two separate proteasomal cleavage products that are not contiguous in the parental protein. Acts as a major component of interferon gamma-induced sensitivity. Plays a key role in apoptosis via the degradation of the apoptotic inhibitor MCL1. May be involved in the inflammatory response pathway. In cancer cells, substitution of isoform 1 (E2) by isoform 2 (E1) results in immunoproteasome deficiency. Required for the differentiation of preadipocytes into adipocytes.
- Molecular Weight
- 30kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC60121
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat