Antibodies
Anti-PRP19 Antibody-Oligo Conjugate
SKU: aoc3202
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PRP19 Antibody-IF1
Antibody Target
- Target
- Pre-mRNA-processing factor 19
- UniProt Number
- Q9UMS4
- Target Description
- Ubiquitin-protein ligase which is a core component of several complexes mainly involved pre-mRNA splicing and DNA repair. Required for pre-mRNA splicing as component of the spliceosome. Core component of the PRP19C/Prp19 complex/NTC/Nineteen complex which is part of the spliceosome and participates in its assembly, its remodeling and is required for its activity. During assembly of the spliceosome, mediates 'Lys-63'-linked polyubiquitination of the U4 spliceosomal protein PRPF3. Ubiquitination of PRPF3 allows its recognition by the U5 component PRPF8 and stabilizes the U4/U5/U6 tri-snRNP spliceosomal complex. Recruited to RNA polymerase II C-terminal domain (CTD) and the pre-mRNA, it may also couple the transcriptional and spliceosomal machineries. The XAB2 complex, which contains PRPF19, is also involved in pre-mRNA splicing, transcription and transcription-coupled repair. Beside its role in pre-mRNA splicing PRPF19, as part of the PRP19-CDC5L complex, plays a role in the DNA damage response/DDR. It is recruited to the sites of DNA damage by the RPA complex where PRPF19 directly ubiquitinates RPA1 and RPA2. 'Lys-63'-linked polyubiquitination of the RPA complex allows the recruitment of the ATR-ATRIP complex and the activation of ATR, a master regulator of the DNA damage response. May also play a role in DNA double-strand break (DSB) repair by recruiting the repair factor SETMAR to altered DNA. As part of the PSO4 complex may also be involved in the DNA interstrand cross-links/ICLs repair process. In addition, may also mediate 'Lys-48'-linked polyubiquitination of substrates and play a role in proteasomal degradation. May play a role in the biogenesis of lipid droplets. May play a role in neural differentiation possibly through its function as part of the spliceosome.
- Molecular Weight
- 55kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC1685
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat