Antibodies
Anti-PSAP Antibody-Oligo Conjugate
SKU: aoc3207
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PSAP Antibody-IF1
Antibody Target
- Target
- Prosaposin
- UniProt Number
- P07602
- Target Description
- Saposin-A and saposin-C stimulate the hydrolysis of glucosylceramide by beta-glucosylceramidase (EC 3.2.1.45) and galactosylceramide by beta-galactosylceramidase (EC 3.2.1.46). Saposin-C apparently acts by combining with the enzyme and acidic lipid to form an activated complex, rather than by solubilizing the substrate.; FUNCTION: Saposin-B stimulates the hydrolysis of galacto-cerebroside sulfate by arylsulfatase A (EC 3.1.6.8), GM1 gangliosides by beta-galactosidase (EC 3.2.1.23) and globotriaosylceramide by alpha-galactosidase A (EC 3.2.1.22). Saposin-B forms a solubilizing complex with the substrates of the sphingolipid hydrolases.; FUNCTION: Saposin-D is a specific sphingomyelin phosphodiesterase activator (EC 3.1.4.12).; FUNCTION: [Prosaposin]: Behaves as a myelinotrophic and neurotrophic factor, these effects are mediated by its G-protein-coupled receptors, GPR37 and GPR37L1, undergoing ligand-mediated internalization followed by ERK phosphorylation signaling.; FUNCTION: Saposins are specific low-molecular mass non-enzymic proteins, they participate in the lysosomal degradation of sphingolipids, which takes place by the sequential action of specific hydrolases.
- Molecular Weight
- 58kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC58322
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human