Antibodies
Anti-PSMA2 Antibody-Oligo Conjugate
SKU: aoc3214
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PSMA2 Antibody-IF1
Antibody Target
- Target
- Proteasome subunit alpha type-2
- UniProt Number
- P25787
- Target Description
- Component of the 20S core proteasome complex involved in the proteolytic degradation of most intracellular proteins. This complex plays numerous essential roles within the cell by associating with different regulatory particles. Associated with two 19S regulatory particles, forms the 26S proteasome and thus participates in the ATP-dependent degradation of ubiquitinated proteins. The 26S proteasome plays a key role in the maintenance of protein homeostasis by removing misfolded or damaged proteins that could impair cellular functions, and by removing proteins whose functions are no longer required. Associated with the PA200 or PA28, the 20S proteasome mediates ubiquitin-independent protein degradation. This type of proteolysis is required in several pathways including spermatogenesis (20S-PA200 complex) or generation of a subset of MHC class I-presented antigenic peptides (20S-PA28 complex).
- Molecular Weight
- 26kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC1465
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat