Antibodies
Anti-PSMC4 Antibody-Oligo Conjugate
SKU: aoc3220
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PSMC4 Antibody-IF1
Antibody Target
- Target
- 26S proteasome regulatory subunit 6B
- UniProt Number
- P43686
- Target Description
- Component of the 26S proteasome, a multiprotein complex involved in the ATP-dependent degradation of ubiquitinated proteins. This complex plays a key role in the maintenance of protein homeostasis by removing misfolded or damaged proteins, which could impair cellular functions, and by removing proteins whose functions are no longer required. Therefore, the proteasome participates in numerous cellular processes, including cell cycle progression, apoptosis, or DNA damage repair. PSMC4 belongs to the heterohexameric ring of AAA (ATPases associated with diverse cellular activities) proteins that unfolds ubiquitinated target proteins that are concurrently translocated into a proteolytic chamber and degraded into peptides.
- Molecular Weight
- 47kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC58702
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat