Antibodies
Anti-PSMD14 Antibody-Oligo Conjugate
SKU: aoc3222
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PSMD14 Antibody-IF1
Antibody Target
- Target
- 26S proteasome non-ATPase regulatory subunit 14
- UniProt Number
- O00487
- Target Description
- Component of the 26S proteasome, a multiprotein complex involved in the ATP-dependent degradation of ubiquitinated proteins. This complex plays a key role in the maintenance of protein homeostasis by removing misfolded or damaged proteins, which could impair cellular functions, and by removing proteins whose functions are no longer required. Therefore, the proteasome participates in numerous cellular processes, including cell cycle progression, apoptosis, or DNA damage repair. The PSMD14 subunit is a metalloprotease that specifically cleaves 'Lys-63'-linked polyubiquitin chains within the complex. Plays a role in response to double-strand breaks (DSBs): acts as a regulator of non-homologous end joining (NHEJ) by cleaving 'Lys-63'-linked polyubiquitin, thereby promoting retention of JMJD2A/KDM4A on chromatin and restricting TP53BP1 accumulation. Also involved in homologous recombination repair by promoting RAD51 loading.
- Molecular Weight
- 35kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC1655
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat