Antibodies
Anti-PTBP1 Antibody-Oligo Conjugate
SKU: aoc3225
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PTBP1 Antibody-IF1
Antibody Target
- Target
- Polypyrimidine tract-binding protein 1
- UniProt Number
- P26599
- Target Description
- Plays a role in pre-mRNA splicing and in the regulation of alternative splicing events. Activates exon skipping of its own pre-mRNA during muscle cell differentiation. Binds to the polypyrimidine tract of introns. May promote RNA looping when bound to two separate polypyrimidine tracts in the same pre-mRNA. May promote the binding of U2 snRNP to pre-mRNA. Cooperates with RAVER1 to modulate switching between mutually exclusive exons during maturation of the TPM1 pre-mRNA. Represses the splicing of MAPT/Tau exon 10. Binds to polypyrimidine-rich controlling element (PCE) of CFTR and promotes exon skipping of CFTR exon 9, thereby antagonizing TIA1 and its role in exon inclusion of CFTR exon 9. Plays a role in the splicing of pyruvate kinase PKM by binding repressively to a polypyrimidine tract flanking PKM exon 9, inhibiting exon 9 inclusion and resulting in exon 10 inclusion and production of the PKM M2 isoform. In case of infection by picornaviruses, binds to the viral internal ribosome entry site (IRES) and stimulates the IRES-mediated translation.
- Molecular Weight
- 60kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCIPELISA
- Clone
- ARC65847
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat