Antibodies
Anti-PTGER2 Antibody-Oligo Conjugate
SKU: aoc3228
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PTGER2 Antibody-IF1
Antibody Target
- Target
- Prostaglandin E2 receptor EP2 subtype
- UniProt Number
- P43116
- Target Description
- Receptor for prostaglandin E2 (PGE2). The activity of this receptor is mediated by G(s) proteins that stimulate adenylate cyclase. The subsequent raise in intracellular cAMP is responsible for the relaxing effect of this receptor on smooth muscle.
- Molecular Weight
- 40kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC1393
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat