Antibodies
Anti-PTP1B Antibody-Oligo Conjugate
SKU: aoc3229
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PTP1B Antibody-IF1
Antibody Target
- Target
- Tyrosine-protein phosphatase non-receptor type 1
- UniProt Number
- P18031
- Target Description
- Tyrosine-protein phosphatase which acts as a regulator of endoplasmic reticulum unfolded protein response. Mediates dephosphorylation of EIF2AK3/PERK; inactivating the protein kinase activity of EIF2AK3/PERK. May play an important role in CKII- and p60c-src-induced signal transduction cascades. May regulate the EFNA5-EPHA3 signaling pathway which modulates cell reorganization and cell-cell repulsion. May also regulate the hepatocyte growth factor receptor signaling pathway through dephosphorylation of MET.
- Molecular Weight
- 50kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC58516
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse