Antibodies
Anti-PU.1/SPI1 Antibody-Oligo Conjugate
SKU: aoc3232
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PU.1/SPI1 Antibody-IF1
Antibody Target
- Target
- Transcription factor PU.1
- UniProt Number
- P17947
- Target Description
- Pioneer transcription factor, which controls hematopoietic cell fate by decompacting stem cell heterochromatin and allowing other transcription factors to enter otherwise inaccessible genomic sites. Once in open chromatin, can directly control gene expression by binding genetic regulatory elements and can also more broadly influence transcription by recruiting transcription factors, such as interferon regulatory factors (IRFs), to otherwise inaccessible genomic regions. Transcriptionally activates genes important for myeloid and lymphoid lineages, such as CSF1R. Transcriptional activation from certain promoters, possibly containing low affinity binding sites, is achieved cooperatively with other transcription factors. FCER1A transactivation is achieved in cooperation with GATA1. May be particularly important for the pro- to pre-B cell transition. Binds (via the ETS domain) onto the purine-rich DNA core sequence 5'-GAGGAA-3', also known as the PU-box. In vitro can bind RNA and interfere with pre-mRNA splicing.
- Molecular Weight
- 31kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIF-PIHCFC (intra)ELISA
- Clone
- ARC63111
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human