Antibodies
Anti-PUMA Antibody-Oligo Conjugate
SKU: aoc3233
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PUMA Antibody-IF1
Antibody Target
- Target
- Bcl-2-binding component 3, isoforms 1/2
- UniProt Number
- Q9BXH1
- Target Description
- Essential mediator of p53/TP53-dependent and p53/TP53-independent apoptosis. Promotes partial unfolding of BCL2L1 and dissociation of BCL2L1 from p53/TP53, releasing the bound p53/TP53 to induce apoptosis. Regulates ER stress-induced neuronal apoptosis.
- Molecular Weight
- 18kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC0247
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat