Antibodies

Anti-QKI Antibody-Oligo Conjugate (ARC2500)

SKU: aoc3242

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-QKI Antibody (ARC2500)-IF1

Antibody Target

Target
KH domain-containing RNA-binding protein QKI
UniProt Number
Q96PU8
Target Description
RNA reader protein, which recognizes and binds specific RNAs, thereby regulating RNA metabolic processes, such as pre-mRNA splicing, circular RNA (circRNA) formation, mRNA export, mRNA stability and/or translation. Involved in various cellular processes, such as mRNA storage into stress granules, apoptosis, lipid deposition, interferon response, glial cell fate and development. Binds to the 5'-NACUAAY-N(1,20)-UAAY-3' RNA core sequence. Acts as a mRNA modification reader that specifically recognizes and binds mRNA transcripts modified by internal N(7)-methylguanine (m7G). Promotes the formation of circular RNAs (circRNAs) during the epithelial to mesenchymal transition and in cardiomyocytes: acts by binding to sites flanking circRNA-forming exons. CircRNAs are produced by back-splicing circularization of pre-mRNAs. Plays a central role in myelinization via 3 distinct mechanisms. First, acts by protecting and promoting stability of target mRNAs such as MBP, SIRT2 and CDKN1B, which promotes oligodendrocyte differentiation. Second, participates in mRNA transport by regulating the nuclear export of MBP mRNA. Finally, indirectly regulates mRNA splicing of MAG pre-mRNA during oligodendrocyte differentiation by acting as a negative regulator of MAG exon 12 alternative splicing: acts by binding to HNRNPA1 mRNA splicing factor, preventing its translation. Involved in microglia differentiation and remyelination by regulating microexon alternative splicing of the Rho GTPase pathway. Involved in macrophage differentiation: promotes monocyte differentiation by regulating pre-mRNA splicing in naive peripheral blood monocytes. Acts as an important regulator of muscle development: required for the contractile function of cardiomyocytes by regulating alternative splicing of cardiomyocyte transcripts. Acts as a negative regulator of thermogenesis by decreasing stability, nuclear export and translation of mRNAs encoding PPARGC1A and UCP1. Also required for visceral endoderm function and blood vessel development. May also play a role in smooth muscle development. In addition to its RNA-binding activity, also acts as a nuclear transcription coactivator for SREBF2/SREBP2.; FUNCTION: [Isoform QKI5]: Nuclear isoform that acts as an indirect regulator of mRNA splicing. Regulates mRNA splicing of MAG pre-mRNA by inhibiting translation of HNRNPA1 mRNA, thereby preventing MAG exon 12 alternative splicing. Involved in oligodendrocyte differentiation by promoting stabilization of SIRT2 mRNA. Acts as a negative regulator of the interferon response by binding to MAVS mRNA, downregulating its expression. Also inhibits the interferon response by binding to fibrinectin FN1 pre-mRNA, repressing EDA exon inclusion in FN1. Delays macrophage differentiation by binding to CSF1R mRNA, promoting its degradation. In addition to its RNA-binding activity, also acts as a nuclear transcription coactivator for SREBF2/SREBP2, promoting SREBF2/SREBP2-dependent cholesterol biosynthesis. SREBF2/SREBP2-dependent cholesterol biosynthesis participates to myelinization and is required for eye lens transparency.; FUNCTION: [Isoform QKI6]: Cytosolic isoform that specifically recognizes and binds mRNA transcripts modified by internal N(7)-methylguanine (m7G). Interaction with G3BP1 promotes localization of m7G-containing mRNAs into stress granules in response to stress, thereby suppressing their translation. Acts as a translational repressor for HNRNPA1 and GLI1. Translation inhibition of HNRNPA1 during oligodendrocyte differentiation prevents inclusion of exon 12 in MAG pre-mRNA splicing. Involved in astrocyte differentiation by regulating translation of target mRNAs.; FUNCTION: [Isoform QKI7]: Cytosolic isoform that specifically recognizes and binds mRNA transcripts modified by internal N(7)-methylguanine (m7G). Interaction with G3BP1 promotes localization of m7G-containing mRNAs into stress granules in response to stress, thereby suppressing their translation. Acts as a negative regulator of angiogenesis by binding to mRNAs encoding CDH5, NLGN1 and TNFAIP6, promoting their degradation. Can also induce apoptosis in the cytoplasm. Heterodimerization with other isoforms results in nuclear translocation of isoform QKI7 and suppression of apoptosis. Also binds some microRNAs: promotes stabilitation of miR-122 by mediating recruitment of poly(A) RNA polymerase TENT2, leading to 3' adenylation and stabilization of miR-122.
Molecular Weight
38kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBIHCICCIPELISA
Clone
ARC2500
Isotype
IgG
Form
Liquid
Immunogen
Synthetic peptide. This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
HumanMouseRat