Antibodies
Anti-R9AP/RGS9BP Antibody-Oligo Conjugate
SKU: aoc3244
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-R9AP/RGS9BP Antibody-IF1
Antibody Target
- Target
- Regulator of G-protein signaling 9-binding protein
- UniProt Number
- Q6ZS82
- Target Description
- Regulator of G protein-coupled receptor (GPCR) signaling in phototransduction. Participates in the recovery phase of visual transduction via its interaction with RGS9-1 isoform. Acts as a membrane-anchor that mediates the targeting of RGS9-1 to the photoreceptor outer segment, where phototransduction takes place. Enhances the ability of RGS9-1 to stimulate G protein GTPase activity, allowing the visual signal to be terminated on the physiologically time scale. It also controls the proteolytic stability of RGS9-1, probably by protecting it from degradation.
- Molecular Weight
- 25kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC61024
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human