Antibodies
Anti-RAB10 Antibody-Oligo Conjugate
SKU: aoc3245
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-RAB10 Antibody-IF1
Antibody Target
- Target
- Ras-related protein Rab-10
- UniProt Number
- P61026
- Target Description
- The small GTPases Rab are key regulators of intracellular membrane trafficking, from the formation of transport vesicles to their fusion with membranes. Rabs cycle between an inactive GDP-bound form and an active GTP-bound form that is able to recruit to membranes different set of downstream effectors directly responsible for vesicle formation, movement, tethering and fusion. That Rab is mainly involved in the biosynthetic transport of proteins from the Golgi to the plasma membrane. Regulates, for instance, SLC2A4/GLUT4 glucose transporter-enriched vesicles delivery to the plasma membrane. In parallel, it regulates the transport of TLR4, a toll-like receptor to the plasma membrane and therefore may be important for innate immune response. Also plays a specific role in asymmetric protein transport to the plasma membrane. In neurons, it is involved in axonogenesis through regulation of vesicular membrane trafficking toward the axonal plasma membrane. In epithelial cells, it regulates transport from the Golgi to the basolateral membrane. May play a role in the basolateral recycling pathway and in phagosome maturation. May play a role in endoplasmic reticulum dynamics and morphology controlling tubulation along microtubules and tubules fusion. Together with LRRK2, RAB8A, and RILPL1, it regulates ciliogenesis. When phosphorylated by LRRK2 on Thr-73, binds RILPL1 and inhibits ciliogenesis. Participates in the export of a subset of neosynthesized proteins through a Rab8-Rab10-Rab11-dependent endososomal export route. Targeted to and stabilized on stressed lysosomes through LRRK2 phosphorylation where it promotes the extracellular release of lysosomal content through EHBP1 and EHNP1L1 effector proteins.; FUNCTION: (Microbial infection) Upon Legionella pneumophila infection promotes endoplasmic reticulum recruitment and bacterial replication. Plays a role in remodeling the Legionella-containing vacuole (LCV) into an endoplasmic reticulum-like vacuole.
- Molecular Weight
- 23kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC55653
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat