Antibodies
Anti-RAB11A/B Antibody-Oligo Conjugate
SKU: aoc3247
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-RAB11A/B Antibody-IF1
Antibody Target
- Target
- Ras-related protein Rab-11A
- UniProt Number
- P62491
- Additional Target Information
- This antibody also binds Ras-related protein Rab-11B, Uniprot:Q15907.
- Target Description
- The small GTPases Rab are key regulators of intracellular membrane trafficking, from the formation of transport vesicles to their fusion with membranes. Rabs cycle between an inactive GDP-bound form and an active GTP-bound form that is able to recruit to membranes different set of downstream effectors directly responsible for vesicle formation, movement, tethering and fusion. The small Rab GTPase RAB11A regulates endocytic recycling. Forms a functional Rab11/RAB11FIP3/dynein complex that regulates the movement of peripheral sorting endosomes (SE) along microtubule tracks toward the microtubule organizing center/centrosome, generating the endosomal recycling compartment (ERC). Acts as a major regulator of membrane delivery during cytokinesis. Together with MYO5B and RAB8A participates in epithelial cell polarization. Together with Rabin8/RAB3IP, RAB8A, the exocyst complex, PARD3, PRKCI, ANXA2, CDC42 and DNMBP promotes transcytosis of PODXL to the apical membrane initiation sites (AMIS), apical surface formation and lumenogenesis. Together with MYO5B participates in CFTR trafficking to the plasma membrane and TF (Transferrin) recycling in nonpolarized cells. Required in a complex with MYO5B and RAB11FIP2 for the transport of NPC1L1 to the plasma membrane. Participates in the sorting and basolateral transport of CDH1 from the Golgi apparatus to the plasma membrane. Regulates the recycling of FCGRT (receptor of Fc region of monomeric IgG) to basolateral membranes. May also play a role in melanosome transport and release from melanocytes. Promotes Rabin8/RAB3IP preciliary vesicular trafficking to mother centriole by forming a ciliary targeting complex containing Rab11, ASAP1, Rabin8/RAB3IP, RAB11FIP3 and ARF4, thereby regulating ciliogenesis initiation. On the contrary, upon LPAR1 receptor signaling pathway activation, interaction with phosphorylated WDR44 prevents Rab11-RAB3IP-RAB11FIP3 complex formation and cilia growth. Participates in the export of a subset of neosynthesized proteins through a Rab8-Rab10-Rab11-endososomal dependent export route via interaction with WDR44.
- Molecular Weight
- 24KDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIHCELISA
- Clone
- ARC51971
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat