Antibodies
Anti-RAB22A Antibody-Oligo Conjugate
SKU: aoc3250
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-RAB22A Antibody-PLA1
Antibody Target
- Target
- Ras-related protein Rab-22A
- UniProt Number
- Q9UL26
- Target Description
- Plays a role in endocytosis and intracellular protein transport. Mediates trafficking of TF from early endosomes to recycling endosomes. Required for NGF-mediated endocytosis of NTRK1, and subsequent neurite outgrowth. Binds GTP and GDP and has low GTPase activity. Alternates between a GTP-bound active form and a GDP-bound inactive form.
- Molecular Weight
- 22 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISA
- Clone
- ARC3128
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat