Antibodies
Anti-RAB27B Antibody-Oligo Conjugate
SKU: aoc3252
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-RAB27B Antibody-IF1
Antibody Target
- Target
- Ras-related protein Rab-27B
- UniProt Number
- O00194
- Target Description
- Small GTPase which cycles between active GTP-bound and inactive GDP-bound states. In its active state, binds to a variety of effector proteins to regulate homeostasis of late endocytic pathway, including endosomal positioning, maturation and secretion. Plays a role in NTRK2/TRKB axonal anterograde transport by facilitating the association of NTRK2/TRKB with KLC1. May be involved in targeting uroplakins to urothelial apical membranes.
- Molecular Weight
- 25kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC67005
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat