Antibodies
Anti-RAB7 Antibody-Oligo Conjugate
SKU: aoc3256
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-RAB7 Antibody-IF1
Antibody Target
- Target
- Ras-related protein Rab-7a
- UniProt Number
- P51149
- Target Description
- The small GTPases Rab are key regulators of intracellular membrane trafficking, from the formation of transport vesicles to their fusion with membranes. Rabs cycle between an inactive GDP-bound form and an active GTP-bound form that is able to recruit to membranes different sets of downstream effectors directly responsible for vesicle formation, movement, tethering and fusion. In its active state, RAB7A binds to a variety of effector proteins playing a key role in the regulation of endo-lysosomal trafficking. Governs early-to-late endosomal maturation, microtubule minus-end as well as plus-end directed endosomal migration and positioning, and endosome-lysosome transport through different protein-protein interaction cascades. Also plays a central role in growth-factor-mediated cell signaling, nutrient-transportor mediated nutrient uptake, neurotrophin transport in the axons of neurons and lipid metabolism. Also involved in regulation of some specialized endosomal membrane trafficking, such as maturation of melanosomes, pathogen-induced phagosomes (or vacuoles) and autophagosomes. Plays a role in the maturation and acidification of phagosomes that engulf pathogens, such as S.aureus and M.tuberculosis. Plays a role in the fusion of phagosomes with lysosomes. In concert with RAC1, plays a role in regulating the formation of RBs (ruffled borders) in osteoclasts. Controls the endosomal trafficking and neurite outgrowth signaling of NTRK1/TRKA. Regulates the endocytic trafficking of the EGF-EGFR complex by regulating its lysosomal degradation. Involved in the ADRB2-stimulated lipolysis through lipophagy, a cytosolic lipase-independent autophagic pathway. Required for the exosomal release of SDCBP, CD63 and syndecan. Required for vesicular trafficking and cell surface expression of ACE2. May play a role in PRPH neuronal intermediate filament assembly.
- Molecular Weight
- 23kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPICCIHCELISA
- Clone
- ARC54437
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat