Antibodies
Anti-RAB8A Antibody-Oligo Conjugate
SKU: aoc3257
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-RAB8A Antibody-IF1
Antibody Target
- Target
- Ras-related protein Rab-8A
- UniProt Number
- P61006
- Target Description
- The small GTPases Rab are key regulators of intracellular membrane trafficking, from the formation of transport vesicles to their fusion with membranes. Rabs cycle between an inactive GDP-bound form and an active GTP-bound form that is able to recruit to membranes different sets of downstream effectors directly responsible for vesicle formation, movement, tethering and fusion. RAB8A is involved in polarized vesicular trafficking and neurotransmitter release. Together with RAB11A, RAB3IP, the exocyst complex, PARD3, PRKCI, ANXA2, CDC42 and DNMBP promotes transcytosis of PODXL to the apical membrane initiation sites (AMIS), apical surface formation and lumenogenesis. Regulates the compacted morphology of the Golgi. Together with MYO5B and RAB11A participates in epithelial cell polarization. Also involved in membrane trafficking to the cilium and ciliogenesis. Together with MICALL2, may also regulate adherens junction assembly. May play a role in insulin-induced transport to the plasma membrane of the glucose transporter GLUT4 and therefore play a role in glucose homeostasis. Involved in autophagy. Participates in the export of a subset of neosynthesized proteins through a Rab8-Rab10-Rab11-dependent endososomal export route. Targeted to and stabilized on stressed lysosomes through LRRK2 phosphorylation. Suppresses stress-induced lysosomal enlargement through EHBP1 and EHNP1L1 effector proteins.
- Molecular Weight
- 24kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIPELISA
- Clone
- ARC2968
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat