Antibodies
Anti-Rac1/2/3 Antibody-Oligo Conjugate
SKU: aoc3259
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Rac1/2/3 Antibody-IF1
Antibody Target
- Target
- Ras-related C3 botulinum toxin substrate 1
- Additional Target Information
- This antibody also binds Ras-related C3 botulinum toxin substrate 2, Uniprot:P15153. This antibody also binds Ras-related C3 botulinum toxin substrate 3, Uniprot:P60763.
- UniProt Number
- P63000
- Target Description
- Plasma membrane-associated small GTPase which cycles between active GTP-bound and inactive GDP-bound states. In its active state, binds to a variety of effector proteins to regulate cellular responses such as secretory processes, phagocytosis of apoptotic cells, epithelial cell polarization, neurons adhesion, migration and differentiation, and growth-factor induced formation of membrane ruffles. Rac1 p21/rho GDI heterodimer is the active component of the cytosolic factor sigma 1, which is involved in stimulation of the NADPH oxidase activity in macrophages. Essential for the SPATA13-mediated regulation of cell migration and adhesion assembly and disassembly. Stimulates PKN2 kinase activity. In concert with RAB7A, plays a role in regulating the formation of RBs (ruffled borders) in osteoclasts. In podocytes, promotes nuclear shuttling of NR3C2; this modulation is required for a proper kidney functioning. Required for atypical chemokine receptor ACKR2-induced LIMK1-PAK1-dependent phosphorylation of cofilin (CFL1) and for up-regulation of ACKR2 from endosomal compartment to cell membrane, increasing its efficiency in chemokine uptake and degradation. In neurons, is involved in dendritic spine formation and synaptic plasticity. In hippocampal neurons, involved in spine morphogenesis and synapse formation, through local activation at synapses by guanine nucleotide exchange factors (GEFs), such as ARHGEF6/ARHGEF7/PIX. In synapses, seems to mediate the regulation of F-actin cluster formation performed by SHANK3. In neurons, plays a crucial role in regulating GABA(A) receptor synaptic stability and hence GABAergic inhibitory synaptic transmission through its role in PAK1 activation and eventually F-actin stabilization. Required for DSG3 translocation to cell-cell junctions, DSG3-mediated organization of cortical F-actin bundles and anchoring of actin at cell junctions; via interaction with DSG3. Subunit of the phagocyte NADPH oxidase complex that mediates the transfer of electrons from cytosolic NADPH to O2 to produce the superoxide anion (O2(-)).; FUNCTION: [Isoform B]: Isoform B has an accelerated GEF-independent GDP/GTP exchange and an impaired GTP hydrolysis, which is restored partially by GTPase-activating proteins. It is able to bind to the GTPase-binding domain of PAK but not full-length PAK in a GTP-dependent manner, suggesting that the insertion does not completely abolish effector interaction.
- Molecular Weight
- 21kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1165
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat