Antibodies
Anti-RACGAP1 Antibody-Oligo Conjugate (ARC57331)
SKU: aoc3260
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-RACGAP1 Antibody (ARC57331)-IF1
Antibody Target
- Target
- Rac GTPase-activating protein 1
- UniProt Number
- Q9H0H5
- Target Description
- Component of the centralspindlin complex that serves as a microtubule-dependent and Rho-mediated signaling required for the myosin contractile ring formation during the cell cycle cytokinesis. Required for proper attachment of the midbody to the cell membrane during cytokinesis. Sequentially binds to ECT2 and RAB11FIP3 which regulates cleavage furrow ingression and abscission during cytokinesis. Plays key roles in controlling cell growth and differentiation of hematopoietic cells through mechanisms other than regulating Rac GTPase activity. Has a critical role in erythropoiesis. Also involved in the regulation of growth-related processes in adipocytes and myoblasts. May be involved in regulating spermatogenesis and in the RACGAP1 pathway in neuronal proliferation. Shows strong GAP (GTPase activation) activity towards CDC42 and RAC1 and less towards RHOA. Essential for the early stages of embryogenesis. May play a role in regulating cortical activity through RHOA during cytokinesis. May participate in the regulation of sulfate transport in male germ cells.
- Molecular Weight
- 71kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC57331
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat