Antibodies
Anti-Rad21 Antibody-Oligo Conjugate
SKU: aoc3264
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-Rad21 Antibody-PLA1
Antibody Target
- Target
- Double-strand-break repair protein rad21 homolog
- UniProt Number
- O60216
- Target Description
- [Double-strand-break repair protein rad21 homolog]: As a member of the cohesin complex, involved in sister chromatid cohesion from the time of DNA replication in S phase to their segregation in mitosis, a function that is essential for proper chromosome segregation, post-replicative DNA repair, and the prevention of inappropriate recombination between repetitive regions. The cohesin complex may also play a role in spindle pole assembly during mitosis. In interphase, cohesins may function in the control of gene expression by binding to numerous sites within the genome. May control RUNX1 gene expression (Probable). Binds to and represses APOB gene promoter. May play a role in embryonic gut development, possibly through the regulation of enteric neuron development.; FUNCTION: [64-kDa C-terminal product]: May promote apoptosis.
- Molecular Weight
- 72kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBELISAChIPChIP-seq
- Clone
- ARC2276
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat