Antibodies
Anti-Rad23A Antibody-Oligo Conjugate
SKU: aoc3265
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Rad23A Antibody-IF1
Antibody Target
- Target
- UV excision repair protein RAD23 homolog A
- UniProt Number
- P54725
- Target Description
- Multiubiquitin chain receptor involved in modulation of proteasomal degradation. Binds to 'Lys-48'-linked polyubiquitin chains in a length-dependent manner and with a lower affinity to 'Lys-63'-linked polyubiquitin chains. Proposed to be capable to bind simultaneously to the 26S proteasome and to polyubiquitinated substrates and to deliver ubiquitinated proteins to the proteasome.; FUNCTION: Involved in nucleotide excision repair and is thought to be functional equivalent for RAD23B in global genome nucleotide excision repair (GG-NER) by association with XPC. In vitro, the XPC:RAD23A dimer has NER activity. Can stabilize XPC.; FUNCTION: (Microbial infection) Involved in Vpr-dependent replication of HIV-1 in non-proliferating cells and primary macrophages. Required for the association of HIV-1 Vpr with the host proteasome.
- Molecular Weight
- 40kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC1271
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse