Antibodies
Anti-Rad51 Antibody-Oligo Conjugate (ARC70197)
SKU: aoc3267
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Rad51 Antibody (ARC70197)-IF1
Antibody Target
- Target
- DNA repair protein RAD51 homolog 1
- UniProt Number
- Q06609
- Target Description
- Plays an important role in homologous strand exchange, a key step in DNA repair through homologous recombination (HR). Binds to single-stranded DNA in an ATP-dependent manner to form nucleoprotein filaments which are essential for the homology search and strand exchange. Catalyzes the recognition of homology and strand exchange between homologous DNA partners to form a joint molecule between a processed DNA break and the repair template. Recruited to resolve stalled replication forks during replication stress. Part of a PALB2-scaffolded HR complex containing BRCA2 and RAD51C and which is thought to play a role in DNA repair by HR. Plays a role in regulating mitochondrial DNA copy number under conditions of oxidative stress in the presence of RAD51C and XRCC3. Also involved in interstrand cross-link repair.
- Molecular Weight
- 37kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCIPELISA
- Clone
- ARC70197
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat