Antibodies

Anti-RAGE Antibody-Oligo Conjugate

SKU: aoc3273

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-RAGE Antibody-IF1

Antibody Target

Target
Advanced glycosylation end product-specific receptor
UniProt Number
Q15109
Target Description
Cell surface pattern recognition receptor that senses endogenous stress signals with a broad ligand repertoire including advanced glycation end products, S100 proteins, high-mobility group box 1 protein/HMGB1, amyloid beta/APP oligomers, nucleic acids, histones, phospholipids and glycosaminoglycans. Advanced glycosylation end products are nonenzymatically glycosylated proteins which accumulate in vascular tissue in aging and at an accelerated rate in diabetes. These ligands accumulate at inflammatory sites during the pathogenesis of various diseases including diabetes, vascular complications, neurodegenerative disorders and cancers, and RAGE transduces their binding into pro-inflammatory responses. Upon ligand binding, uses TIRAP and MYD88 as adapters to transduce the signal ultimately leading to the induction of inflammatory cytokines IL6, IL8 and TNFalpha through activation of NF-kappa-B. Interaction with S100A12 on endothelium, mononuclear phagocytes, and lymphocytes triggers cellular activation, with generation of key pro-inflammatory mediators. Interaction with S100B after myocardial infarction may play a role in myocyte apoptosis by activating ERK1/2 and p53/TP53 signaling. Contributes to the translocation of amyloid-beta peptide (ABPP) across the cell membrane from the extracellular to the intracellular space in cortical neurons. ABPP-initiated RAGE signaling, especially stimulation of p38 mitogen-activated protein kinase (MAPK), has the capacity to drive a transport system delivering ABPP as a complex with RAGE to the intraneuronal space. Participates in endothelial albumin transcytosis together with HMGB1 through the RAGE/SRC/Caveolin-1 pathway, leading to endothelial hyperpermeability. Mediates the loading of HMGB1 in extracellular vesicles (EVs) that shuttle HMGB1 to hepatocytes by transferrin-mediated endocytosis and subsequently promote hepatocyte pyroptosis by activating the NLRP3 inflammasome. Binds to DNA and promotes extracellular hypomethylated DNA (CpG DNA) uptake by cells via the endosomal route to activate inflammatory responses. Mediates phagocytosis by non-professional phagocytes (NPP) and this is enhanced by binding to ligands including RNA, DNA, HMGB1 and histones. Promotes NPP-mediated phagocytosis of Saccharomyces cerevisiae spores by binding to RNA attached to the spore wall. Also promotes NPP-mediated phagocytosis of apoptotic cells. Following DNA damage, recruited to DNA double-strand break sites where it colocalizes with the MRN repair complex via interaction with double-strand break repair protein MRE11. Enhances the endonuclease activity of MRE11, promoting the end resection of damaged DNA. Promotes DNA damage repair in trophoblasts which enhances trophoblast invasion and contributes to placental development and maintenance. Protects cells from DNA replication stress by localizing to damaged replication forks where it stabilizes the MCM2-7 complex and promotes faithful progression of the replication fork. Mediates the production of reactive oxygen species (ROS) in human endothelial cells.
Molecular Weight
43kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBIF-PIHCELISA
Clone
ARC60991
Isotype
IgG
Form
Liquid
Immunogen
Recombinant protein (or fragment).This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
HumanMouseRat
Back to Product Catalog