Antibodies
Anti-RALBP1 Antibody-Oligo Conjugate
SKU: aoc3277
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-RALBP1 Antibody-IF1
Antibody Target
- Target
- RalA-binding protein 1
- UniProt Number
- Q15311
- Target Description
- Multifunctional protein that functions as a downstream effector of RALA and RALB. As a GTPase-activating protein/GAP can inactivate CDC42 and RAC1 by stimulating their GTPase activity. As part of the Ral signaling pathway, may also regulate ligand-dependent EGF and insulin receptors-mediated endocytosis. During mitosis, may act as a scaffold protein in the phosphorylation of EPSIN/EPN1 by the mitotic kinase cyclin B-CDK1, preventing endocytosis during that phase of the cell cycle. During mitosis, also controls mitochondrial fission as an effector of RALA. Recruited to mitochondrion by RALA, acts as a scaffold to foster the mitotic kinase cyclin B-CDK1-mediated phosphorylation and activation of DNM1L.; FUNCTION: Could also function as a primary ATP-dependent active transporter for glutathione conjugates of electrophiles. May also actively catalyze the efflux of a wide range of substrates including xenobiotics like doxorubicin (DOX) contributing to cell multidrug resistance.
- Molecular Weight
- 76kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- IHCICCELISA
- Clone
- ARC1707
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat