Antibodies
Anti-RANBP9 Antibody-Oligo Conjugate
SKU: aoc3279
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-RANBP9 Antibody-IF1
Antibody Target
- Target
- Ran-binding protein 9
- UniProt Number
- Q96S59
- Target Description
- May act as scaffolding protein, and as adapter protein to couple membrane receptors to intracellular signaling pathways (Probable). Acts as a mediator of cell spreading and actin cytoskeleton rearrangement. Core component of the CTLH E3 ubiquitin-protein ligase complex that selectively accepts ubiquitin from UBE2H and mediates ubiquitination and subsequent proteasomal degradation of the transcription factor HBP1. May be involved in signaling of ITGB2/LFA-1 and other integrins. Enhances HGF-MET signaling by recruiting Sos and activating the Ras pathway. Enhances dihydrotestosterone-induced transactivation activity of AR, as well as dexamethasone-induced transactivation activity of NR3C1, but not affect estrogen-induced transactivation. Stabilizes TP73 isoform Alpha, probably by inhibiting its ubiquitination, and increases its proapoptotic activity. Inhibits the kinase activity of DYRK1A and DYRK1B. Inhibits FMR1 binding to RNA.
- Molecular Weight
- 78kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2397
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat