Antibodies
Anti-RARS Antibody-Oligo Conjugate
SKU: aoc3285
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-RARS Antibody-IF1
Antibody Target
- Target
- Arginine--tRNA ligase, cytoplasmic
- UniProt Number
- P54136
- Target Description
- Forms part of a macromolecular complex that catalyzes the attachment of specific amino acids to cognate tRNAs during protein synthesis. Modulates the secretion of AIMP1 and may be involved in generation of the inflammatory cytokine EMAP2 from AIMP1.
- Molecular Weight
- 75kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC65518
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse