Antibodies
Anti-Rb Antibody-Oligo Conjugate
SKU: aoc3290
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Rb Antibody-IF1
Antibody Target
- Target
- Retinoblastoma-associated protein
- UniProt Number
- P06400
- Target Description
- Tumor suppressor that is a key regulator of the G1/S transition of the cell cycle. The hypophosphorylated form binds transcription regulators of the E2F family, preventing transcription of E2F-responsive genes. Both physically blocks E2Fs transactivating domain and recruits chromatin-modifying enzymes that actively repress transcription. Cyclin and CDK-dependent phosphorylation of RB1 induces its dissociation from E2Fs, thereby activating transcription of E2F responsive genes and triggering entry into S phase. RB1 also promotes the G0-G1 transition upon phosphorylation and activation by CDK3/cyclin-C. Directly involved in heterochromatin formation by maintaining overall chromatin structure and, in particular, that of constitutive heterochromatin by stabilizing histone methylation. Recruits and targets histone methyltransferases SUV39H1, KMT5B and KMT5C, leading to epigenetic transcriptional repression. Controls histone H4 'Lys-20' trimethylation. Inhibits the intrinsic kinase activity of TAF1. Mediates transcriptional repression by SMARCA4/BRG1 by recruiting a histone deacetylase (HDAC) complex to the c-FOS promoter. In resting neurons, transcription of the c-FOS promoter is inhibited by BRG1-dependent recruitment of a phospho-RB1-HDAC1 repressor complex. Upon calcium influx, RB1 is dephosphorylated by calcineurin, which leads to release of the repressor complex.; FUNCTION: (Microbial infection) In case of viral infections, interactions with SV40 large T antigen, HPV E7 protein or adenovirus E1A protein induce the disassembly of RB1-E2F1 complex thereby disrupting RB1's activity.
- Molecular Weight
- 106kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPIHCELISA
- Clone
- ARC76431
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human