Antibodies
Anti-RbAp46 Antibody-Oligo Conjugate
SKU: aoc3291
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-RbAp46 Antibody-IF1
Antibody Target
- Target
- Histone-binding protein RBBP7
- UniProt Number
- Q16576
- Target Description
- Core histone-binding subunit that may target chromatin remodeling factors, histone acetyltransferases and histone deacetylases to their histone substrates in a manner that is regulated by nucleosomal DNA. Component of several complexes which regulate chromatin metabolism. These include the type B histone acetyltransferase (HAT) complex, which is required for chromatin assembly following DNA replication; the core histone deacetylase (HDAC) complex, which promotes histone deacetylation and consequent transcriptional repression; the nucleosome remodeling and histone deacetylase complex (the NuRD complex), which promotes transcriptional repression by histone deacetylation and nucleosome remodeling; and the PRC2/EED-EZH2 complex, which promotes repression of homeotic genes during development; and the NURF (nucleosome remodeling factor) complex.
- Molecular Weight
- 48kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC55384
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat