Antibodies
Anti-RBM3 Antibody-Oligo Conjugate
SKU: aoc3294
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-RBM3 Antibody-IF1
Antibody Target
- Target
- RNA-binding protein 3
- UniProt Number
- P98179
- Target Description
- Cold-inducible mRNA binding protein that enhances global protein synthesis at both physiological and mild hypothermic temperatures. Reduces the relative abundance of microRNAs, when overexpressed. Enhances phosphorylation of translation initiation factors and active polysome formation.
- Molecular Weight
- 17kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC2882
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat