Antibodies
Anti-RBMX/hnRNP G Antibody-Oligo Conjugate
SKU: aoc3295
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-RBMX/hnRNP G Antibody-IF1
Antibody Target
- Target
- RNA-binding motif protein, X chromosome
- UniProt Number
- P38159
- Target Description
- RNA-binding protein that plays several role in the regulation of pre- and post-transcriptional processes. Implicated in tissue-specific regulation of gene transcription and alternative splicing of several pre-mRNAs. Binds to and stimulates transcription from the tumor suppressor TXNIP gene promoter; may thus be involved in tumor suppression. When associated with SAFB, binds to and stimulates transcription from the SREBF1 promoter. Associates with nascent mRNAs transcribed by RNA polymerase II. Component of the supraspliceosome complex that regulates pre-mRNA alternative splice site selection. Can either activate or suppress exon inclusion; acts additively with TRA2B to promote exon 7 inclusion of the survival motor neuron SMN2. Represses the splicing of MAPT/Tau exon 10. Binds preferentially to single-stranded 5'-CC[A/C]-rich RNA sequence motifs localized in a single-stranded conformation; probably binds RNA as a homodimer. Binds non-specifically to pre-mRNAs. Also plays a role in the cytoplasmic TNFR1 trafficking pathways; promotes both the IL-1-beta-mediated inducible proteolytic cleavage of TNFR1 ectodomains and the release of TNFR1 exosome-like vesicles to the extracellular compartment.
- Molecular Weight
- 42kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC54054
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat