Antibodies
Anti-RBPJK Antibody-Oligo Conjugate
SKU: aoc3297
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-RBPJK Antibody-IF1
Antibody Target
- Target
- Recombining binding protein suppressor of hairless
- UniProt Number
- Q06330
- Target Description
- Transcriptional regulator that plays a central role in Notch signaling, a signaling pathway involved in cell-cell communication that regulates a broad spectrum of cell-fate determinations. Acts as a transcriptional repressor when it is not associated with Notch proteins. When associated with some NICD product of Notch proteins (Notch intracellular domain), it acts as a transcriptional activator that activates transcription of Notch target genes. Probably represses or activates transcription via the recruitment of chromatin remodeling complexes containing histone deacetylase or histone acetylase proteins, respectively. Specifically binds to the immunoglobulin kappa-type J segment recombination signal sequence. Binds specifically to methylated DNA. Binds to the oxygen responsive element of COX4I2 and activates its transcription under hypoxia conditions (4% oxygen). Negatively regulates the phagocyte oxidative burst in response to bacterial infection by repressing transcription of NADPH oxidase subunits.
- Molecular Weight
- 56kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0894
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse