Antibodies
Anti-RCL Antibody-Oligo Conjugate
SKU: aoc3299
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-RCL Antibody-IF1
Antibody Target
- Target
- 5-hydroxymethyl-dUMP N-hydrolase
- UniProt Number
- O43598
- Target Description
- Part of a nucleotide salvage pathway that eliminates epigenetically modified 5-hydroxymethyl-dCMP (hmdCMP) in a two-step process entailing deamination to cytotoxic 5-hydroxymethyl-dUMP (hmdUMP), followed by its hydrolysis into 5-hydroxymethyluracil (hmU) and 2-deoxy-D-ribose 5-phosphate (deoxyribosephosphate). Catalyzes the second step in that pathway, the hydrolysis of the N-glycosidic bond in hmdUMP, degrading this cytotoxic nucleotide to avoid its genomic integration.
- Molecular Weight
- 19kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC2571
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse