Antibodies
Anti-RELB Antibody-Oligo Conjugate
SKU: aoc3301
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-RELB Antibody-IF1
Antibody Target
- Target
- Transcription factor RelB
- UniProt Number
- Q01201
- Target Description
- NF-kappa-B is a pleiotropic transcription factor which is present in almost all cell types and is involved in many biological processed such as inflammation, immunity, differentiation, cell growth, tumorigenesis and apoptosis. NF-kappa-B is a homo- or heterodimeric complex formed by the Rel-like domain-containing proteins RELA/p65, RELB, NFKB1/p105, NFKB1/p50, REL and NFKB2/p52. The dimers bind at kappa-B sites in the DNA of their target genes and the individual dimers have distinct preferences for different kappa-B sites that they can bind with distinguishable affinity and specificity. Different dimer combinations act as transcriptional activators or repressors, respectively. NF-kappa-B is controlled by various mechanisms of post-translational modification and subcellular compartmentalization as well as by interactions with other cofactors or corepressors. NF-kappa-B complexes are held in the cytoplasm in an inactive state complexed with members of the NF-kappa-B inhibitor (I-kappa-B) family. In a conventional activation pathway, I-kappa-B is phosphorylated by I-kappa-B kinases (IKKs) in response to different activators, subsequently degraded thus liberating the active NF-kappa-B complex which translocates to the nucleus. NF-kappa-B heterodimeric RelB-p50 and RelB-p52 complexes are transcriptional activators. RELB neither associates with DNA nor with RELA/p65 or REL. Stimulates promoter activity in the presence of NFKB2/p49. As a member of the NUPR1/RELB/IER3 survival pathway, may provide pancreatic ductal adenocarcinoma with remarkable resistance to cell stress, such as starvation or gemcitabine treatment. Regulates the circadian clock by repressing the transcriptional activator activity of the CLOCK-BMAL1 heterodimer in a CRY1/CRY2 independent manner. Increased repression of the heterodimer is seen in the presence of NFKB2/p52. Is required for both T and B lymphocyte maturation and function.
- Molecular Weight
- 62kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCIPELISA
- Clone
- ARC59947
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat