Antibodies

Anti-REST Antibody-Oligo Conjugate

SKU: aoc3305

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Proximity Ligation Assay Oligossee protocol

PLA1 Oligo Details

5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'

View Paper

An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.

Anti-REST Antibody-PLA1

Antibody Target

Target
RE1-silencing transcription factor
UniProt Number
Q13127
Target Description
Transcriptional repressor which binds neuron-restrictive silencer element (NRSE) and represses neuronal gene transcription in non-neuronal cells. Restricts the expression of neuronal genes by associating with two distinct corepressors, SIN3A and RCOR1, which in turn recruit histone deacetylase to the promoters of REST-regulated genes. Mediates repression by recruiting the BHC complex at RE1/NRSE sites which acts by deacetylating and demethylating specific sites on histones, thereby acting as a chromatin modifier. Transcriptional repression by REST-CDYL via the recruitment of histone methyltransferase EHMT2 may be important in transformation suppression. Represses the expression of SRRM4 in non-neural cells to prevent the activation of neural-specific splicing events and to prevent production of REST isoform 3. Repressor activity may be inhibited by forming heterodimers with isoform 3, thereby preventing binding to NRSE or binding to corepressors and leading to derepression of target genes. Also maintains repression of neuronal genes in neural stem cells, and allows transcription and differentiation into neurons by dissociation from RE1/NRSE sites of target genes. Thereby is involved in maintaining the quiescent state of adult neural stem cells and preventing premature differentiation into mature neurons. Plays a role in the developmental switch in synaptic NMDA receptor composition during postnatal development, by repressing GRIN2B expression and thereby altering NMDA receptor properties from containing primarily GRIN2B to primarily GRIN2A subunits. Acts as a regulator of osteoblast differentiation. Key repressor of gene expression in hypoxia; represses genes in hypoxia by direct binding to an RE1/NRSE site on their promoter regions. May also function in stress resistance in the brain during aging; possibly by regulating expression of genes involved in cell death and in the stress response. Repressor of gene expression in the hippocampus after ischemia by directly binding to RE1/NRSE sites and recruiting SIN3A and RCOR1 to promoters of target genes, thereby promoting changes in chromatin modifications and ischemia-induced cell death. After ischemia, might play a role in repression of miR-132 expression in hippocampal neurons, thereby leading to neuronal cell death. Negatively regulates the expression of SRRM3 in breast cancer cell lines.; FUNCTION: [Isoform 3]: Binds to the 3' region of the neuron-restrictive silencer element (NRSE), with lower affinity than full-length REST isoform 1. Exhibits weaker repressor activity compared to isoform 1. May negatively regulate the repressor activity of isoform 1 by binding to isoform 1, thereby preventing its binding to NRSE and leading to derepression of target genes. However, in another study, does not appear to be implicated in repressor activity of a NRSE motif-containing reporter construct nor in inhibitory activity on the isoform 1 transcriptional repressor activity. Post-transcriptional inactivation of REST by SRRM4-dependent alternative splicing into isoform 3 is required in mechanosensory hair cells in the inner ear for derepression of neuronal genes and hearing.
Molecular Weight
122kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBIPELISA
Clone
ARC0755
Isotype
IgG
Form
Liquid
Immunogen
Synthetic peptide. This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
HumanMouseRat