Antibodies
Anti-Ret Antibody-Oligo Conjugate
SKU: aoc3306
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Ret Antibody-IF1
Antibody Target
- Target
- Proto-oncogene tyrosine-protein kinase receptor Ret
- UniProt Number
- P07949
- Target Description
- Receptor tyrosine-protein kinase involved in numerous cellular mechanisms including cell proliferation, neuronal navigation, cell migration, and cell differentiation in response to glia cell line-derived growth family factors (GDNF, NRTN, ARTN, PSPN and GDF15). In contrast to most receptor tyrosine kinases, RET requires not only its cognate ligands but also coreceptors, for activation. GDNF ligands (GDNF, NRTN, ARTN, PSPN and GDF15) first bind their corresponding GDNFR coreceptors (GFRA1, GFRA2, GFRA3, GFRA4 and GFRAL, respectively), triggering RET autophosphorylation and activation, leading to activation of downstream signaling pathways, including the MAPK- and AKT-signaling pathways. Acts as a dependence receptor via the GDNF-GFRA1 signaling: in the presence of the ligand GDNF in somatotrophs within pituitary, promotes survival and down regulates growth hormone (GH) production, but triggers apoptosis in absence of GDNF. Required for the molecular mechanisms orchestration during intestine organogenesis via the ARTN-GFRA3 signaling: involved in the development of enteric nervous system and renal organogenesis during embryonic life, and promotes the formation of Peyer's patch-like structures, a major component of the gut-associated lymphoid tissue. Mediates, through interaction with GDF15-receptor GFRAL, GDF15-induced cell-signaling in the brainstem which triggers an aversive response, characterized by nausea, vomiting, and/or loss of appetite in response to various stresses. Modulates cell adhesion via its cleavage by caspase in sympathetic neurons and mediates cell migration in an integrin (e.g. ITGB1 and ITGB3)-dependent manner. Also active in the absence of ligand, triggering apoptosis through a mechanism that requires receptor intracellular caspase cleavage. Triggers the differentiation of rapidly adapting (RA) mechanoreceptors. Involved in the development of the neural crest. Regulates nociceptor survival and size. Phosphorylates PTK2/FAK1.; FUNCTION: [Isoform 1]: Isoform 1 in complex with GFRAL induces higher activation of MAPK-signaling pathway than isoform 2 in complex with GFRAL.
- Molecular Weight
- 124 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC51764
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse