Antibodies
Anti-RING1 Antibody-Oligo Conjugate
SKU: aoc3312
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-RING1 Antibody-IF1
Antibody Target
- Target
- E3 ubiquitin-protein ligase RING1
- UniProt Number
- Q06587
- Target Description
- Constitutes one of the E3 ubiquitin-protein ligases that mediate monoubiquitination of 'Lys-119' of histone H2A, thereby playing a central role in histone code and gene regulation. H2A 'Lys-119' ubiquitination gives a specific tag for epigenetic transcriptional repression and participates in X chromosome inactivation of female mammals. Essential component of a Polycomb group (PcG) multiprotein PRC1-like complex, a complex class required to maintain the transcriptionally repressive state of many genes, including Hox genes, throughout development. PcG PRC1 complex acts via chromatin remodeling and modification of histones, rendering chromatin heritably changed in its expressibility. Compared to RNF2/RING2, it does not have the main E3 ubiquitin ligase activity on histone H2A, and it may rather act as a modulator of RNF2/RING2 activity.
- Molecular Weight
- 42kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2278
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human