Antibodies

Anti-RIP3 Antibody-Oligo Conjugate

SKU: aoc3315

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-RIP3 Antibody-IF1

Antibody Target

Target
Receptor-interacting serine/threonine-protein kinase 3
UniProt Number
Q9Y572
Target Description
Serine/threonine-protein kinase that activates necroptosis and apoptosis, two parallel forms of cell death. Necroptosis, a programmed cell death process in response to death-inducing TNF-alpha family members, is triggered by RIPK3 following activation by ZBP1. Activated RIPK3 forms a necrosis-inducing complex and mediates phosphorylation of MLKL, promoting MLKL localization to the plasma membrane and execution of programmed necrosis characterized by calcium influx and plasma membrane damage. In addition to TNF-induced necroptosis, necroptosis can also take place in the nucleus in response to orthomyxoviruses infection: following ZBP1 activation, which senses double-stranded Z-RNA structures, nuclear RIPK3 catalyzes phosphorylation and activation of MLKL, promoting disruption of the nuclear envelope and leakage of cellular DNA into the cytosol. Also regulates apoptosis: apoptosis depends on RIPK1, FADD and CASP8, and is independent of MLKL and RIPK3 kinase activity. Phosphorylates RIPK1: RIPK1 and RIPK3 undergo reciprocal auto- and trans-phosphorylation. In some cell types, also able to restrict viral replication by promoting cell death-independent responses. In response to Zika virus infection in neurons, promotes a cell death-independent pathway that restricts viral replication: together with ZBP1, promotes a death-independent transcriptional program that modifies the cellular metabolism via up-regulation expression of the enzyme ACOD1/IRG1 and production of the metabolite itaconate. Itaconate inhibits the activity of succinate dehydrogenase, generating a metabolic state in neurons that suppresses replication of viral genomes. RIPK3 binds to and enhances the activity of three metabolic enzymes: GLUL, GLUD1, and PYGL. These metabolic enzymes may eventually stimulate the tricarboxylic acid cycle and oxidative phosphorylation, which could result in enhanced ROS production.; FUNCTION: (Microbial infection) In case of herpes simplex virus 1/HHV-1 infection, forms heteromeric amyloid structures with HHV-1 protein RIR1/ICP6 which may inhibit RIPK3-mediated necroptosis, thereby preventing host cell death pathway and allowing viral evasion.
Molecular Weight
57kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBIHCELISA
Clone
AMC0707
Isotype
IgG1 κ
Form
Liquid
Immunogen
Synthetic peptide. This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Mouse
Species Reactivity
MouseRat
Back to Product Catalog