Antibodies
Anti-RNF10 Antibody-Oligo Conjugate
SKU: aoc3320
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-RNF10 Antibody-IF1
Antibody Target
- Target
- E3 ubiquitin-protein ligase RNF10
- UniProt Number
- Q8N5U6
- Target Description
- E3 ubiquitin-protein ligase that catalyzes monoubiquitination of 40S ribosomal proteins RPS2/us5 and RPS3/us3 in response to ribosome stalling. Part of a ribosome quality control that takes place when ribosomes have stalled during translation initiation (iRQC): RNF10 acts by mediating monoubiquitination of RPS2/us5 and RPS3/us3, promoting their degradation by the proteasome. Also promotes ubiquitination of 40S ribosomal proteins in response to ribosome stalling during translation elongation. The action of RNF10 in iRQC is counteracted by USP10. May also act as a transcriptional factor involved in the regulation of MAG (Myelin-associated glycoprotein) expression. Acts as a regulator of Schwann cell differentiation and myelination.
- Molecular Weight
- 90kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC66424
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat